Top » Catalog » SNPs » Z2293

$18.00

Z2293
[Z2293]

Z2293
hg38 Position: ChrY:10140324..10140324
Ancestral: G
Derived: A
Reference: Victar Mas (2012)
ISOGG Haplogroup: not listed
Comments: approximate to Z644
Forward Primer: Z2293_F TTGTGGTGGGTCAAGGTAGC
Reverse Primer: Z2293_R GCGCTGAAAACTCAAAAAGG
Reviews

Customers who bought this product also purchased
M267
M267
ZS6366
ZS6366
ZS1471
ZS1471
HU33
HU33
FT161154
FT161154
ZS1464
ZS1464
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies