Top » Catalog » SNPs » Z2293

$18.00

Z2293
[Z2293]

Z2293
hg38 Position: ChrY:10140324..10140324
Ancestral: G
Derived: A
Reference: Victar Mas (2012)
ISOGG Haplogroup: not listed
Comments: approximate to Z644
Forward Primer: Z2293_F TTGTGGTGGGTCAAGGTAGC
Reverse Primer: Z2293_R GCGCTGAAAACTCAAAAAGG
Reviews

Customers who bought this product also purchased
ZS1409
ZS1409
FGC12
FGC12
Z642
Z642
FGC1707
FGC1707
FGC5230
FGC5230
J1-M267 Superclade Panel
J1-M267 Superclade Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x L829
$18.00
Haplogroup Info
Other products
Currencies