Top » Catalog » SNPs » Z2293

$18.00

Z2293
[Z2293]

Z2293
hg38 Position: ChrY:10140324..10140324
Ancestral: G
Derived: A
Reference: Victar Mas (2012)
ISOGG Haplogroup: not listed
Comments: approximate to Z644
Forward Primer: Z2293_F TTGTGGTGGGTCAAGGTAGC
Reverse Primer: Z2293_R GCGCTGAAAACTCAAAAAGG
Reviews

Customers who bought this product also purchased
BY74
BY74
FGC1723
FGC1723
FGC11
FGC11
FGC1695
FGC1695
DYS454
DYS454
CDY
CDY
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies