Top » Catalog » SNPs » FGC4745

$18.00

FGC4745
[FGC4745]

FGC4745
hg38 Position: ChrY:8762155..8762155
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1-YSC234
Comments: Downstream from YSC234
Forward Primer: FGC4745_F ACCATGCAGCCCTCTGATAG
Reverse Primer: FGC4745_R ATTGCACAAGCTGTCCACAC
Reviews

Customers who bought this product also purchased
M267
M267
L858
L858
ZS6262
ZS6262
J1-M267 Superclade Panel
J1-M267 Superclade Panel
FGC4726
FGC4726
FGC4737
FGC4737
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies