Top » Catalog » SNPs » FGC4745

$18.00

FGC4745
[FGC4745]

FGC4745
hg38 Position: ChrY:8762155..8762155
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1-YSC234
Comments: Downstream from YSC234
Forward Primer: FGC4745_F ACCATGCAGCCCTCTGATAG
Reverse Primer: FGC4745_R ATTGCACAAGCTGTCCACAC
Reviews

Customers who bought this product also purchased
L862
L862
FGC12
FGC12
ZS6205
ZS6205
FGC1707
FGC1707
ZS6359
ZS6359
FGC5
FGC5
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies