Top » Catalog » SNPs » CTS11741

$18.00

CTS11741
[CTS11741]

CTS11741
hg38 Position: ChrY:21084179..21084179
Ancestral: G
Derived: A
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: J1a1b1b1a2a1a1a
Comments: Syn. with CTS11741; downstream PF4843
Forward Primer: CTS11741_F TGCACACAAAAGAAATGTGATG
Reverse Primer: CTS11741_R TGCAGGCTGAAGAGAGAGTG
Reviews

Customers who bought this product also purchased
ZS3292
ZS3292
FGC2
FGC2
FGC12
FGC12
ZS3290
ZS3290
DNA Sample Kit
DNA Sample Kit
FGC4429
FGC4429
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies