Top » Catalog » SNPs » PF4881

$18.00

PF4881
[PF4881]

PF4881
hg38 Position: ChrY:20815121..20815121
Ancestral: A
Derived: G
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: J1
Comments: Extracted from genome study of Sardinian samples
Forward Primer: PF4881_F CCAAAACACCCAGAAAATGG
Reverse Primer: PF4881_R CAAGTCCACTGGTTGGAAGG
Reviews

Customers who bought this product also purchased
Y136125
Y136125
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
Y16646
Y16646
ZS3698
ZS3698
Z1889
Z1889
L862
L862
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies