Top » Catalog » SNPs » PF4881

$18.00

PF4881
[PF4881]

PF4881
hg38 Position: ChrY:20815121..20815121
Ancestral: A
Derived: G
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: J1
Comments: Extracted from genome study of Sardinian samples
Forward Primer: PF4881_F CCAAAACACCCAGAAAATGG
Reverse Primer: PF4881_R CAAGTCCACTGGTTGGAAGG
Reviews

Customers who bought this product also purchased
M96
M96
Z18297
Z18297
Y138150
Y138150
M267
M267
ZS4313
ZS4313
Y136125
Y136125
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies