Top » Catalog » SNPs » FGC32363

$18.00

FGC32363
[FGC32363]

FGC32363
hg38 Position: ChrY:12398023..12398023
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Below L513 > Z16361 > CTS750 > FGC13411
Forward Primer: FGC32363_F CCAGAAAAGTGAAATTTGGGTG
Reverse Primer: FGC32363_R GCAACATAGCAAGACCCCAG
Reviews

Customers who bought this product also purchased
Z253
Z253
Z16361
Z16361
Z39589
Z39589
Z16340
Z16340
FGC13422
FGC13422
DF49
DF49
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies