Top » Catalog » SNPs » FGC32363

$18.00

FGC32363
[FGC32363]

FGC32363
hg38 Position: ChrY:12398023..12398023
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Below L513 > Z16361 > CTS750 > FGC13411
Forward Primer: FGC32363_F CCAGAAAAGTGAAATTTGGGTG
Reverse Primer: FGC32363_R GCAACATAGCAAGACCCCAG
Reviews

Customers who bought this product also purchased
Z39589
Z39589
Z16340
Z16340
FGC13422
FGC13422
DF49
DF49
R1b-L513 Panel
R1b-L513 Panel
Z17626
Z17626
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies