Top » Catalog » SNPs » BY75

$18.00

BY75
[BY75]

BY75
hg38 Position: ChrY:2878979..2878979
Ancestral: G
Derived: A
Reference: FTDNA
ISOGG Haplogroup: J1
Comments: Downstream ZS2374
Forward Primer: BY75_F CCAGGCTTTTTCCTTGTACG
Reverse Primer: BY75_R AAGCTGAAGTTGGGATGGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies