Top » Catalog » SNPs » ZS10317

$18.00

ZS10317
[ZS10317]

ZS10317
hg38 Position: ChrY:15163714..15163714
Ancestral: G
Derived: A
Reference: Victar Mas (2016)
ISOGG Haplogroup: J1
Comments: downstream S12192
Forward Primer: ZS10317_F CTCCAACAGGTGTTCCAGTATG
Reverse Primer: ZS10317_R CTGAGAAGAAGCCTCCCTCTATC
Reviews

Customers who bought this product also purchased
ZS2373
ZS2373
V1662
V1662
ZS2374
ZS2374
ZS10316
ZS10316
J1-ZS2374 Panel
J1-ZS2374 Panel
S15852
S15852
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies