Top » Catalog » SNPs » ZS2374

$18.00

ZS2374
[ZS2374]

ZS2374
hg38 Position: ChrY:7936194..7936194
Ancestral: A
Derived: C
Reference: Victar Mas (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: Found in Big Y sample 207808; downstream S12192
Forward Primer: ZS2374_F AGGTACTTGGGCAAGGAATG
Reverse Primer: ZS2374_R AATTGTGACTTTCATGAAGGAATG
Reviews

Customers who bought this product also purchased
ZS2373
ZS2373
ZS10316
ZS10316
J1-ZS2374 Panel
J1-ZS2374 Panel
S15852
S15852
ZS10317
ZS10317
BY117385
BY117385
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies