Top » Catalog » SNPs » ZS2374

$18.00

ZS2374
[ZS2374]

ZS2374
hg38 Position: ChrY:7936194..7936194
Ancestral: A
Derived: C
Reference: Victar Mas (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: Found in Big Y sample 207808; downstream S12192
Forward Primer: ZS2374_F AGGTACTTGGGCAAGGAATG
Reverse Primer: ZS2374_R AATTGTGACTTTCATGAAGGAATG
Reviews

Customers who bought this product also purchased
S15852
S15852
ZS10317
ZS10317
BY117385
BY117385
BY75
BY75
V1662
V1662
ZS2373
ZS2373
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies