Top » Catalog » SNPs » S20171

$18.00

S20171
[S20171]

S20171
hg38 Position: ChrY:15653119..15653119
Ancestral: A
Derived: G
Reference: Jim Wilson (2014)
ISOGG Haplogroup: J1a2a1a2d2b2b2c4d2a
Comments: Below FGC11 > S21237
Forward Primer: S20171_F CCAAAAGAGCATAAAAGAGCAAAG
Reverse Primer: S20171_R TAAGGAGACTGAAATTGAAATAAACATG
Reviews

Customers who bought this product also purchased
ZS2130
ZS2130
ZS2139
ZS2139
ZS3795
ZS3795
FGC1707
FGC1707
Y4348
Y4348
FGC1695
FGC1695
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies