Top » Catalog » SNPs » S20171

$18.00

S20171
[S20171]

S20171
hg38 Position: ChrY:15653119..15653119
Ancestral: A
Derived: G
Reference: Jim Wilson (2014)
ISOGG Haplogroup: J1a2a1a2d2b2b2c4d2a
Comments: .
Forward Primer: S20171_F CCAAAAGAGCATAAAAGAGCAAAG
Reverse Primer: S20171_R TAAGGAGACTGAAATTGAAATAAACATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies