Top » Catalog » SNPs » Z18243

$18.00

Z18243
[Z18243]

Z18243
hg38 Position: ChrY:15780950..15780950
Ancestral: G
Derived: C
Reference: Victar Mas (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: Found in Big Y samples 278174; 220756; 272200; downstream FGC1698
Forward Primer: Z18243_F CTTAGTTTCATTTTGTCATGAAATTCAC
Reverse Primer: Z18243_R CAAACTTCTGGGTATTCATTTCTCTG
Reviews

Customers who bought this product also purchased
Z18258
Z18258
Y40110
Y40110
FGC3718
FGC3718
ZS2244
ZS2244
FGC1723
FGC1723
ZS4960
ZS4960
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies