Top » Catalog » SNPs » Z18243

$18.00

Z18243
[Z18243]

Z18243
hg38 Position: ChrY:15780950..15780950
Ancestral: G
Derived: C
Reference: Victar Mas (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: Found in Big Y samples 278174; 220756; 272200; downstream FGC1698
Forward Primer: Z18243_F CTTAGTTTCATTTTGTCATGAAATTCAC
Reverse Primer: Z18243_R CAAACTTCTGGGTATTCATTTCTCTG
Reviews

Customers who bought this product also purchased
P58
P58
FGC1707
FGC1707
DNA Sample Kit
DNA Sample Kit
L858
L858
ZS9681
ZS9681
FGC1695
FGC1695
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies