Top » Catalog » SNPs » Z18258

$18.00

Z18258
[Z18258]

Z18258
hg38 Position: ChrY:20985002..20985002
Ancestral: G
Derived: C
Reference: Victar Mas (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: Found in Big Y samples M9290; 222132; downstream FGC3708
Forward Primer: Z18258_F GGGGCATTTTGATTTTGTTG
Reverse Primer: Z18258_R GGCACACCTCCTCCACTTAG
Reviews

Customers who bought this product also purchased
FGC19543
FGC19543
Y4348
Y4348
ZS9734
ZS9734
FGC1696
FGC1696
ZS3820
ZS3820
FGC3722
FGC3722
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies