Top » Catalog » SNPs » ZS1706

$18.00

ZS1706
[ZS1706]

ZS1706
hg38 Position: ChrY:7534664..7534664
Ancestral: C
Derived: G
Reference: Victar Mas (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: Found in Big Y sample 843; approximate to L823
Forward Primer: ZS1706_F CCTTAGCTATTTTCCTTTTCCAATC
Reverse Primer: ZS1706_R CAGGAAATACCCTATTTGAATTGC
Reviews

Customers who bought this product also purchased
L858
L858
ZS1766
ZS1766
FGC1707
FGC1707
ZS1711
ZS1711
J1-M267 Superclade Panel
J1-M267 Superclade Panel
FGC8223
FGC8223
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies