Top » Catalog » SNPs » ZS1706

$18.00

ZS1706
[ZS1706]

ZS1706
hg38 Position: ChrY:7534664..7534664
Ancestral: C
Derived: G
Reference: Victar Mas (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: Found in Big Y sample 843; approximate to L823
Forward Primer: ZS1706_F CCTTAGCTATTTTCCTTTTCCAATC
Reverse Primer: ZS1706_R CAGGAAATACCCTATTTGAATTGC
Reviews

Customers who bought this product also purchased
FGC8223
FGC8223
ZS5573
ZS5573
YSC0000076
YSC0000076
ZS1713
ZS1713
FGC12
FGC12
ZS1711
ZS1711
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies