Top » Catalog » SNPs » ZS9681

$18.00

ZS9681
[ZS9681]

ZS9681
hg38 Position: ChrY:13608178..13608178
Ancestral: C
Derived: T
Reference: Victar Mas (2015)
ISOGG Haplogroup: J1
Comments: downstream Z18243
Forward Primer: ZS9681_F GGATCACAGTGAAATCCTCAAAAG
Reverse Primer: ZS9681_R CCAATTTACTGGCAGTAGAGGC
Reviews

Customers who bought this product also purchased
FGC1695
FGC1695
Z18243
Z18243
ZS2167
ZS2167
FGC1696
FGC1696
FGC3723
FGC3723
Z18253
Z18253
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies