Top » Catalog » SNPs » FGC12836

$18.00

FGC12836
[FGC12836]

FGC12836
hg38 Position: ChrY:16089562..16089562
Ancestral: G
Derived: A
Reference: Full Genomes (2014)
ISOGG Haplogroup: J1
Comments: Downstream L829 > FGC12805
Forward Primer: FGC12836_F AAAACAGGCTTTTATATTAATTCAGTTTTC
Reverse Primer: FGC12836_R ATTCACTGGCCTTGGGTTC
Reviews

Customers who bought this product also purchased
ZS176
ZS176
M267
M267
FGC12
FGC12
PF4869
PF4869
Z28290
Z28290
FGC11
FGC11
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies