Top » Catalog » SNPs » FGC12836

$18.00

FGC12836
[FGC12836]

FGC12836
hg38 Position: ChrY:16089562..16089562
Ancestral: G
Derived: A
Reference: Full Genomes (2014)
ISOGG Haplogroup: J1
Comments: Downstream L829 > FGC12805
Forward Primer: FGC12836_F AAAACAGGCTTTTATATTAATTCAGTTTTC
Reverse Primer: FGC12836_R ATTCACTGGCCTTGGGTTC
Reviews

Customers who bought this product also purchased
ZS176
ZS176
M267
M267
FGC12
FGC12
Z28296
Z28296
J1-M267 Superclade Panel
J1-M267 Superclade Panel
PF4869
PF4869
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies