Top » Catalog » SNPs » FGC4411

$18.00

FGC4411
[FGC4411]

FGC4411
hg38 Position: ChrY:8519430..8519430
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1-FGC12
Comments: Downstream of J1-FGC12
Forward Primer: FGC4411_F TCATAATTTCATTGACTAATTCAATTGC
Reverse Primer: FGC4411_R CATTTATGCAGTAAAGGGCACG
Reviews

Customers who bought this product also purchased
ZS5230
ZS5230
ZS5224
ZS5224
ZS5833
ZS5833
FGC12532
FGC12532
ZS5226
ZS5226
Y130515
Y130515
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies