Top » Catalog » SNPs » FGC4429

$18.00

FGC4429
[FGC4429]

FGC4429
hg38 Position: ChrY:18873916..18873916
Ancestral: A
Derived: C
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC4429_F AGATGGGGCTTTTGGTCAG
Reverse Primer: FGC4429_R TGGGAGGCTAAAGTGAGAGG
Reviews

Customers who bought this product also purchased
ZS8303
ZS8303
ZS9296
ZS9296
ZS10545
ZS10545
FGC4417
FGC4417
A18075
A18075
FGC11
FGC11
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies