Top » Catalog » SNPs » FGC4429

$18.00

FGC4429
[FGC4429]

FGC4429
hg38 Position: ChrY:18873916..18873916
Ancestral: A
Derived: C
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC4429_F AGATGGGGCTTTTGGTCAG
Reverse Primer: FGC4429_R TGGGAGGCTAAAGTGAGAGG
Reviews

Customers who bought this product also purchased
FT63131
FT63131
FT160700
FT160700
Y113059
Y113059
ZS9500
ZS9500
ZS5230
ZS5230
Y98661
Y98661
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies