Top » Catalog » SNPs » FGC4430

$19.00

FGC4430
[FGC4430]

FGC4430
hg38 Position: ChrY:18884240..18884240
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC4430_F GGTACATTTTTGGAAAAGACATTAATTAG
Reverse Primer: FGC4430_R AGTAGGAGAAAAGAAAGAAATCAGAGC
Reviews

Customers who bought this product also purchased
BY167527
BY167527
Y137280
Y137280
Y14643
Y14643
ZS8848
ZS8848
J1-FGC4415 Panel
J1-FGC4415 Panel
FGC1723
FGC1723
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies