Top » Catalog » SNPs » ZS5227

$18.00

ZS5227
[ZS5227]

ZS5227
hg38 Position: ChrY:9009938..9009938
Ancestral: G
Derived: A
Reference: Victar Mas (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: downstream FGC4415. Found in Big Y sample 190294
Forward Primer: ZS5227_F CAGTCCTGTCCCCAGGAC
Reverse Primer: ZS5227_R TGATGGATTCCCATGAGGTTAG
Reviews

Customers who bought this product also purchased
FGC8712
FGC8712
ZS8865
ZS8865
FGC12
FGC12
FGC1721
FGC1721
FGC1713
FGC1713
FGC42781
FGC42781
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies