Top » Catalog » SNPs » ZS5227

$18.00

ZS5227
[ZS5227]

ZS5227
hg38 Position: ChrY:9009938..9009938
Ancestral: G
Derived: A
Reference: Victar Mas (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: downstream FGC4415. Found in Big Y sample 190294
Forward Primer: ZS5227_F CAGTCCTGTCCCCAGGAC
Reverse Primer: ZS5227_R TGATGGATTCCCATGAGGTTAG
Reviews

Customers who bought this product also purchased
ZS5224
ZS5224
ZS5833
ZS5833
FGC12532
FGC12532
ZS5226
ZS5226
ZS5230
ZS5230
FGC60148
FGC60148
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies