Top » Catalog » SNPs » ZS4733

$18.00

ZS4733
[ZS4733]

ZS4733
hg38 Position: ChrY:15934165..15934165
Ancestral: C
Derived: T
Reference: Victar Mas (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: downstream FGC1723; Found in Big Y sample 301262
Forward Primer: ZS4733_F AAAGTCCATACACATTAGAAAAAAATGC
Reverse Primer: ZS4733_R CTGTGCAGCACAGGAGACAG
Reviews

Customers who bought this product also purchased
ZS4946
ZS4946
M267
M267
ZS9915
ZS9915
FGC1695
FGC1695
ZS4740
ZS4740
M96
M96
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies