Top » Catalog » SNPs » ZS4733

$18.00

ZS4733
[ZS4733]

ZS4733
hg38 Position: ChrY:15934165..15934165
Ancestral: C
Derived: T
Reference: Victar Mas (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: downstream FGC1723; Found in Big Y sample 301262
Forward Primer: ZS4733_F AAAGTCCATACACATTAGAAAAAAATGC
Reverse Primer: ZS4733_R CTGTGCAGCACAGGAGACAG
Reviews

Customers who bought this product also purchased
FGC11
FGC11
BY8
BY8
FGC34373
FGC34373
FGC1707
FGC1707
BY4
BY4
ZS4726
ZS4726
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies