Top » Catalog » SNPs » ZS4733

$18.00

ZS4733
[ZS4733]

ZS4733
hg38 Position: ChrY:15934165..15934165
Ancestral: C
Derived: T
Reference: Victar Mas (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: downstream FGC1723; Found in Big Y sample 301262
Forward Primer: ZS4733_F AAAGTCCATACACATTAGAAAAAAATGC
Reverse Primer: ZS4733_R CTGTGCAGCACAGGAGACAG
Reviews

Customers who bought this product also purchased
BY16791
BY16791
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
ZS4727
ZS4727
FGC11
FGC11
BY8
BY8
FGC34373
FGC34373
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies