Top » Catalog » SNPs » ZS4733

$18.00

ZS4733
[ZS4733]

ZS4733
hg38 Position: ChrY:15934165..15934165
Ancestral: C
Derived: T
Reference: Victar Mas (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: downstream FGC1723; Found in Big Y sample 301262
Forward Primer: ZS4733_F AAAGTCCATACACATTAGAAAAAAATGC
Reverse Primer: ZS4733_R CTGTGCAGCACAGGAGACAG
Reviews

Customers who bought this product also purchased
FGC1695
FGC1695
ZS4740
ZS4740
M96
M96
Y138029
Y138029
L858
L858
BY16791
BY16791
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies