Top » Catalog » SNPs » ZS9318

$18.00

ZS9318
[ZS9318]

ZS9318
hg38 Position: ChrY:20881340..20881340
Ancestral: C
Derived: T
Reference: Victar Mas (2015)
ISOGG Haplogroup: J1 (not listed)
Comments: downstream FGC1723
Forward Primer: ZS9318_F GTTGTGGGAGAGACCAAAGG
Reverse Primer: ZS9318_R CCCTGTTGTGAACCAAAACC
Reviews

Customers who bought this product also purchased
ZS9306
ZS9306
L858
L858
FGC44917
FGC44917
M267
M267
ZS11995
ZS11995
BY16791
BY16791
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies