Top » Catalog » SNPs » BY136

$18.00

BY136
[BY136]

BY136
HG19 Position: ChrY:20929150..20929150
Ancestral: A
Derived: T
Reference: FTDNA (2014)
ISOGG Haplogroup: J1
Comments: Aka FGC19909
Forward Primer: BY136_F GAGGCTCTGAAAGCAGAAGAG
Reverse Primer: BY136_R TCCTGGCCTGTCAACAAATC
Reviews

Customers who bought this product also purchased
FGC1721
FGC1721
ZS10760
ZS10760
ZS12606
ZS12606
FGC1695
FGC1695
ZS12607
ZS12607
FGC11
FGC11
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies