Top » Catalog » SNPs » BY136

$17.50

BY136
[BY136]

BY136
HG19 Position: ChrY:23091036..23091036
Ancestral: A
Derived: T
Reference: FTDNA (2014)
ISOGG Haplogroup: J1
Comments: Aka FGC19909
Forward Primer: BY136_F GAGGCTCTGAAAGCAGAAGAG
Reverse Primer: BY136_R TCCTGGCCTGTCAACAAATC
Reviews

Customers who bought this product also purchased
FGC5
FGC5
FGC4415
FGC4415
BY9
BY9
FGC1707
FGC1707
BY8
BY8
YSC0000076
YSC0000076
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies