Top » Catalog » SNPs » BY136

$18.00

BY136
[BY136]

BY136
hg38 Position: ChrY:20929150..20929150
Ancestral: A
Derived: T
Reference: FTDNA (2014)
ISOGG Haplogroup: J1
Comments: Aka FGC19909
Forward Primer: BY136_F GAGGCTCTGAAAGCAGAAGAG
Reverse Primer: BY136_R TCCTGGCCTGTCAACAAATC
Reviews

Customers who bought this product also purchased
ZS5010
ZS5010
DNA Sample Kit
DNA Sample Kit
ZS2010
ZS2010
M242
M242
FGC2
FGC2
ZS9318
ZS9318
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies