Top » Catalog » SNPs » BY136

$18.00

BY136
[BY136]

BY136
hg38 Position: ChrY:20929150..20929150
Ancestral: A
Derived: T
Reference: FTDNA (2014)
ISOGG Haplogroup: J1
Comments: Aka FGC19909
Forward Primer: BY136_F GAGGCTCTGAAAGCAGAAGAG
Reverse Primer: BY136_R TCCTGGCCTGTCAACAAATC
Reviews

Customers who bought this product also purchased
ZS5486
ZS5486
ZS2001
ZS2001
ZS5638
ZS5638
ZS2017
ZS2017
ZS2028
ZS2028
FGC29863
FGC29863
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies