Top » Catalog » SNPs » BY136

$18.00

BY136
[BY136]

BY136
HG19 Position: ChrY:23091036..23091036
Ancestral: A
Derived: T
Reference: FTDNA (2014)
ISOGG Haplogroup: J1
Comments: Aka FGC19909
Forward Primer: BY136_F GAGGCTCTGAAAGCAGAAGAG
Reverse Primer: BY136_R TCCTGGCCTGTCAACAAATC
Reviews

Customers who bought this product also purchased
FGC3723
FGC3723
ZS4063
ZS4063
M267
M267
FGC1723
FGC1723
ZS4062
ZS4062
FGC5
FGC5
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies