Top » Catalog » SNPs » BY136

$18.00

BY136
[BY136]

BY136
hg38 Position: ChrY:20929150..20929150
Ancestral: A
Derived: T
Reference: FTDNA (2014)
ISOGG Haplogroup: J1
Comments: Aka FGC19909
Forward Primer: BY136_F GAGGCTCTGAAAGCAGAAGAG
Reverse Primer: BY136_R TCCTGGCCTGTCAACAAATC
Reviews

Customers who bought this product also purchased
L222.2
L222.2
ZS9512
ZS9512
ZS9514
ZS9514
ZS2006
ZS2006
ZS10046
ZS10046
ZS10044
ZS10044
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies