Top » Catalog » SNPs » BY136

$18.00

BY136
[BY136]

BY136
hg38 Position: ChrY:20929150..20929150
Ancestral: A
Derived: T
Reference: FTDNA (2014)
ISOGG Haplogroup: J1
Comments: Aka FGC19909
Forward Primer: BY136_F GAGGCTCTGAAAGCAGAAGAG
Reverse Primer: BY136_R TCCTGGCCTGTCAACAAATC
Reviews

Customers who bought this product also purchased
ZS2740
ZS2740
Y133592
Y133592
FGC58290
FGC58290
Y11545
Y11545
ZS2754
ZS2754
Y184791
Y184791
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies