Top » Catalog » SNPs » ZS10545

$18.00

ZS10545
[ZS10545]

ZS10545
hg38 Position: ChrY:19181255..19181255
Ancestral: T
Derived: C
Reference: Victar Mas (2016)
ISOGG Haplogroup: J1
Comments: downstream FGC4429 Aka FGC4720
Forward Primer: ZS10545_F TGGTAGCTTCCTTCCAGCAC
Reverse Primer: ZS10545_R GCAATGGCCAATTGGATTAC
Reviews

Customers who bought this product also purchased
J1-M267 Superclade Panel
J1-M267 Superclade Panel
FGC4429
FGC4429
FGC4708
FGC4708
ZS8303
ZS8303
FGC4411
FGC4411
ZS9296
ZS9296
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies