Top » Catalog » SNPs » ZS10545

$18.00

ZS10545
[ZS10545]

ZS10545
HG19 Position: ChrY:21343141..21343141
Ancestral: T
Derived: C
Reference: Victar Mas (2016)
ISOGG Haplogroup: J1
Comments: downstream FGC4429 Aka FGC4720
Forward Primer: ZS10545_F TGGTAGCTTCCTTCCAGCAC
Reverse Primer: ZS10545_R GCAATGGCCAATTGGATTAC
Reviews

Customers who bought this product also purchased
FGC4430
FGC4430
J1-M267 Superclade Panel
J1-M267 Superclade Panel
FGC4429
FGC4429
FGC4708
FGC4708
ZS8303
ZS8303
FGC4411
FGC4411
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies