Top » Catalog » SNPs » ZS10545

$18.00

ZS10545
[ZS10545]

ZS10545
hg38 Position: ChrY:19181255..19181255
Ancestral: T
Derived: C
Reference: Victar Mas (2016)
ISOGG Haplogroup: J1
Comments: downstream FGC4429 Aka FGC4720
Forward Primer: ZS10545_F TGGTAGCTTCCTTCCAGCAC
Reverse Primer: ZS10545_R GCAATGGCCAATTGGATTAC
Reviews

Customers who bought this product also purchased
FGC4708
FGC4708
ZS8303
ZS8303
FGC4411
FGC4411
ZS9296
ZS9296
FGC4417
FGC4417
ZS8307
ZS8307
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies