Top » Catalog » SNPs » ZS10625

$18.00

ZS10625
[ZS10625]

ZS10625
hg38 Position: ChrY:16455009..16455009
Ancestral: C
Derived: T
Reference: Victar Mas (2016)
ISOGG Haplogroup: J1
Comments: downstream FGC4708
Forward Primer: ZS10625_F AAGCATAGTCTTTTACCACTAAATTTGAG
Reverse Primer: ZS10625_R TGGGCCATAATACAGTGTGATG
Reviews

Customers who bought this product also purchased
FGC4705
FGC4705
L858
L858
FGC1695
FGC1695
FGC1707
FGC1707
FGC2
FGC2
FGC4422
FGC4422
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies