Top » Catalog » SNPs » ZS2028

$18.00

ZS2028
[ZS2028]

ZS2028
hg38 Position: ChrY:13665819..13665819
Ancestral: G
Derived: A
Reference: Victar Mas (2014)
ISOGG Haplogroup: J1a (not listed)
Comments: Found in Big Y sample M6525; downstream BY8 > BY136
Forward Primer: ZS2028_F CCAACATTCCCATATCCAAAGAG
Reverse Primer: ZS2028_R AGCAGCAGAAACCCACTCAC
Reviews

Customers who bought this product also purchased
ZS2022
ZS2022
ZS5638
ZS5638
ZS2017
ZS2017
BY4
BY4
FGC4415
FGC4415
ZS5486
ZS5486
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies