Top » Catalog » SNPs » ZS2028

$18.00

ZS2028
[ZS2028]

ZS2028
hg38 Position: ChrY:13665819..13665819
Ancestral: G
Derived: A
Reference: Victar Mas (2014)
ISOGG Haplogroup: J1a (not listed)
Comments: Found in Big Y sample M6525; downstream BY8 > BY136
Forward Primer: ZS2028_F CCAACATTCCCATATCCAAAGAG
Reverse Primer: ZS2028_R AGCAGCAGAAACCCACTCAC
Reviews

Customers who bought this product also purchased
FGC1695
FGC1695
ZS2042
ZS2042
FGC12
FGC12
ZS2010
ZS2010
L858
L858
Z18231
Z18231
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies