Top » Catalog » SNPs » ZS2072

$18.00

ZS2072
[ZS2072]

ZS2072
hg38 Position: ChrY:16784936..16784936
Ancestral: G
Derived: A
Reference: Victar Mas (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: Found in Big Y sample 119630; downstream BY4 > BY6
Forward Primer: ZS2072_F TTAATATGTCATTTATCCTCTCAGTCATTAATAG
Reverse Primer: ZS2072_R CTCTATTCTAAAGCTCTCATTTCATATAATAAG
Reviews

Customers who bought this product also purchased
ZS6992
ZS6992
BY8
BY8
FGC39468
FGC39468
ZS11633
ZS11633
FGC1707
FGC1707
ZS4087
ZS4087
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x YSEQ-Gamma
1 x YSEQ-Beta
1 x mtComplete
1 x HVR2
1 x HVR1
1 x mtUpgrade
$483.00
Haplogroup Info
Other products
Currencies