Top » Catalog » SNPs » ZS2072

$19.00

ZS2072
[ZS2072]

ZS2072
hg38 Position: ChrY:16784936..16784936
Ancestral: G
Derived: A
Reference: Victar Mas (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: Found in Big Y sample 119630; downstream BY4 > BY6
Forward Primer: ZS2072_F TTAATATGTCATTTATCCTCTCAGTCATTAATAG
Reverse Primer: ZS2072_R CTCTATTCTAAAGCTCTCATTTCATATAATAAG
Reviews

Customers who bought this product also purchased
ZS8508
ZS8508
Z640
Z640
FGC20523
FGC20523
Y184770
Y184770
FGC1701
FGC1701
FTA79814
FTA79814
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies