Top » Catalog » SNPs » BY6

$18.00

BY6
[BY6]

BY6
hg38 Position: ChrY:15077416..15077416
Ancestral: G
Derived: A
Reference: FTDNA
ISOGG Haplogroup: J1
Comments: .
Forward Primer: BY6_F CATAATTTCATGGGCTGTTCTAGC
Reverse Primer: BY6_R CATCCATGGCCATTCACTC
Reviews

Customers who bought this product also purchased
ZS6992
ZS6992
BY8
BY8
FGC1695
FGC1695
ZS2069
ZS2069
FGC12
FGC12
FGC39468
FGC39468
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies