Top » Catalog » SNPs » BY6

$18.00

BY6
[BY6]

BY6
hg38 Position: ChrY:15077416..15077416
Ancestral: G
Derived: A
Reference: FTDNA
ISOGG Haplogroup: J1
Comments: .
Forward Primer: BY6_F CATAATTTCATGGGCTGTTCTAGC
Reverse Primer: BY6_R CATCCATGGCCATTCACTC
Reviews

Customers who bought this product also purchased
ZS4082
ZS4082
FGC43091
FGC43091
ZS11025
ZS11025
ZS4086
ZS4086
ZS2053
ZS2053
ZS2050
ZS2050
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies