Top » Catalog » SNPs » BY6

$18.00

BY6
[BY6]

BY6
hg38 Position: ChrY:15077416..15077416
Ancestral: G
Derived: A
Reference: FTDNA
ISOGG Haplogroup: J1
Comments: .
Forward Primer: BY6_F CATAATTTCATGGGCTGTTCTAGC
Reverse Primer: BY6_R CATCCATGGCCATTCACTC
Reviews

Customers who bought this product also purchased
ZS6992
ZS6992
BY8
BY8
M267
M267
BY4
BY4
ZS2056
ZS2056
J1-M267 Superclade Panel
J1-M267 Superclade Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies