Top » Catalog » SNPs » BY9

$18.00

BY9
[BY9]

BY9
hg38 Position: ChrY:14067457..14067457
Ancestral: G
Derived: A
Reference: FTDNA
ISOGG Haplogroup: J1
Comments: Aka FGC14303
Forward Primer: BY9_F GTGCTGGTGGAGGCTATGG
Reverse Primer: BY9_R TTGAGTTGACAGTGGTGACAGC
Reviews

Customers who bought this product also purchased
YP5322
YP5322
YP1506
YP1506
Y34286
Y34286
Y2395
Y2395
KMS133
KMS133
Z93
Z93
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies