Top » Catalog » SNPs » BY9

$17.50

BY9
[BY9]

BY9
HG19 Position: ChrY:16179337..16179337
Ancestral: G
Derived: A
Reference: FTDNA
ISOGG Haplogroup: J1
Comments: Aka FGC14303
Forward Primer: BY9_F GTGCTGGTGGAGGCTATGG
Reverse Primer: BY9_R TTGAGTTGACAGTGGTGACAGC
Reviews

Customers who bought this product also purchased
ZS9176
ZS9176
L858
L858
FGC3723
FGC3723
ZS4063
ZS4063
M267
M267
FGC1723
FGC1723
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies