Top » Catalog » SNPs » BY9

$18.00

BY9
[BY9]

BY9
HG19 Position: ChrY:14067457..14067457
Ancestral: G
Derived: A
Reference: FTDNA
ISOGG Haplogroup: J1
Comments: Aka FGC14303
Forward Primer: BY9_F GTGCTGGTGGAGGCTATGG
Reverse Primer: BY9_R TTGAGTTGACAGTGGTGACAGC
Reviews

Customers who bought this product also purchased
Z94
Z94
ZS10760
ZS10760
ZS12606
ZS12606
FGC1721
FGC1721
FGC1695
FGC1695
ZS12607
ZS12607
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies