Top » Catalog » SNPs » BY9

$18.00

BY9
[BY9]

BY9
HG19 Position: ChrY:16179337..16179337
Ancestral: G
Derived: A
Reference: FTDNA
ISOGG Haplogroup: J1
Comments: Aka FGC14303
Forward Primer: BY9_F GTGCTGGTGGAGGCTATGG
Reverse Primer: BY9_R TTGAGTTGACAGTGGTGACAGC
Reviews

Customers who bought this product also purchased
Y928
Y928
L657
L657
Y920
Y920
R1a-Z93 Panel
R1a-Z93 Panel
BY6
BY6
Z2123
Z2123
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies