Top » Catalog » Y SNPs » BY9

$18.00

BY9
[BY9]

BY9
hg38 Position: ChrY:14067457..14067457
Ancestral: G
Derived: A
Reference: FTDNA
ISOGG Haplogroup: J1
Comments: Aka FGC14303
Forward Primer: BY9_F GTGCTGGTGGAGGCTATGG
Reverse Primer: BY9_R TTGAGTTGACAGTGGTGACAGC
Reviews

Customers who bought this product also purchased
ZS2022
ZS2022
FGC31327
FGC31327
ZS2006
ZS2006
FGC14310
FGC14310
FT388822
FT388822
Z42543
Z42543
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies