Top » Catalog » SNPs » ZS4062

$17.50

ZS4062
[ZS4062]

ZS4062
HG19 Position: ChrY:7721649..7721649
Ancestral: A
Derived: G
Reference: Victar Mas (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: downstream BY8; Found in Big Y sample M6217
Forward Primer: ZS4062_F CAAAGAAGGACATTACATAATAGTAAAGGTC
Reverse Primer: ZS4062_R CCCTTACTAGCCACAAAATAATTCAC
Reviews

Customers who bought this product also purchased
FGC1723
FGC1723
BY136
BY136
FGC5
FGC5
FGC4415
FGC4415
BY9
BY9
FGC1707
FGC1707
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies