Top » Catalog » SNPs » ZS4062

$18.00

ZS4062
[ZS4062]

ZS4062
HG19 Position: ChrY:7721649..7721649
Ancestral: A
Derived: G
Reference: Victar Mas (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: downstream BY8; Found in Big Y sample M6217
Forward Primer: ZS4062_F CAAAGAAGGACATTACATAATAGTAAAGGTC
Reverse Primer: ZS4062_R CCCTTACTAGCCACAAAATAATTCAC
Reviews

Customers who bought this product also purchased
BY9
BY9
FGC1707
FGC1707
BY8
BY8
YSC0000076
YSC0000076
J1-M267 Superclade Panel
J1-M267 Superclade Panel
BY4
BY4
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies