Top » Catalog » SNPs » ZS4062

$18.00

ZS4062
[ZS4062]

ZS4062
HG19 Position: ChrY:7721649..7721649
Ancestral: A
Derived: G
Reference: Victar Mas (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: downstream BY8; Found in Big Y sample M6217
Forward Primer: ZS4062_F CAAAGAAGGACATTACATAATAGTAAAGGTC
Reverse Primer: ZS4062_R CCCTTACTAGCCACAAAATAATTCAC
Reviews

Customers who bought this product also purchased
Z640
Z640
ZS9176
ZS9176
L858
L858
FGC3723
FGC3723
ZS4063
ZS4063
M267
M267
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies