Top » Catalog » SNPs » ZS4062

$18.00

ZS4062
[ZS4062]

ZS4062
hg38 Position: ChrY:7853608..7853608
Ancestral: A
Derived: G
Reference: Victar Mas (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: downstream BY8; Found in Big Y sample M6217
Forward Primer: ZS4062_F CAAAGAAGGACATTACATAATAGTAAAGGTC
Reverse Primer: ZS4062_R CCCTTACTAGCCACAAAATAATTCAC
Reviews

Customers who bought this product also purchased
FGC1721
FGC1721
FGC1695
FGC1695
ZS10760
ZS10760
ZS12606
ZS12606
ZS1951
ZS1951
Y14282
Y14282
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies