Top » Catalog » SNPs » ZS4062

$19.00

ZS4062
[ZS4062]

ZS4062
hg38 Position: ChrY:7853608..7853608
Ancestral: A
Derived: G
Reference: Victar Mas (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: downstream BY8; Found in Big Y sample M6217
Forward Primer: ZS4062_F CAAAGAAGGACATTACATAATAGTAAAGGTC
Reverse Primer: ZS4062_R CCCTTACTAGCCACAAAATAATTCAC
Reviews

Customers who bought this product also purchased
BY78102
BY78102
PH282
PH282
FGC58293
FGC58293
FGC58302
FGC58302
YMA126
YMA126
FGC58306
FGC58306
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies