Top » Catalog » SNPs » ZS3857

$18.00

ZS3857
[ZS3857]

ZS3857
hg38 Position: ChrY:9961322..9961322
Ancestral: G
Derived: T
Reference: Victar Mas (2015)
ISOGG Haplogroup: J1 (not listed)
Comments: Downstream FGC8810. Found in Big Y sample M8919
Forward Primer: ZS3857_F CATAATTCTTAAAATTAACAGAGTAATCTGTAAGA
Reverse Primer: ZS3857_R CCTCATGGGCTCAAGCG
Reviews

Customers who bought this product also purchased
ZS3856
ZS3856
FGC8812
FGC8812
FGC1696
FGC1696
BY136022
BY136022
FGC1707
FGC1707
ZS8281
ZS8281
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies