Top » Catalog » SNPs » FGC4440

$18.00

FGC4440
[FGC4440]

FGC4440
hg38 Position: ChrY:2801950..2801950
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC4440_F TCAAATAACAGTCATAAAAACATTGTCAG
Reverse Primer: FGC4440_R CAGTATTCACAAGGGCAAAGAGAC
Reviews

Customers who bought this product also purchased
ZS10555
ZS10555
BY198337
BY198337
ZS8289
ZS8289
FGC60675
FGC60675
ZS1922
ZS1922
FGC59129
FGC59129
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies