Top » Catalog » SNPs » FGC4440

$18.00

FGC4440
[FGC4440]

FGC4440
hg38 Position: ChrY:2801950..2801950
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC4440_F TCAAATAACAGTCATAAAAACATTGTCAG
Reverse Primer: FGC4440_R CAGTATTCACAAGGGCAAAGAGAC
Reviews

Customers who bought this product also purchased
BY9586
BY9586
FGC51899
FGC51899
ZS12078
ZS12078
FGC8812
FGC8812
Z17615
Z17615
FGC36738
FGC36738
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies