Top » Catalog » SNPs » FGC4440

$18.00

FGC4440
[FGC4440]

FGC4440
hg38 Position: ChrY:2801950..2801950
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC4440_F TCAAATAACAGTCATAAAAACATTGTCAG
Reverse Primer: FGC4440_R CAGTATTCACAAGGGCAAAGAGAC
Reviews

Customers who bought this product also purchased
FGC4459
FGC4459
FGC4452
FGC4452
FGC5
FGC5
FGC4441
FGC4441
ZS1918
ZS1918
FGC1707
FGC1707
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies